Cutaneous Vascular Malformations Research Articles

KTWS (Klippel-Trenaunay-Weber syndrome): A systematic presentation of a rare disease.

Klippel-Trenaunay-Weber syndrome (KTWS) is a rare disease with a wide range of manifestations. KTWS is characterized by a clinical triad of varicosities of the extremities, cutaneous vascular malformations, and hypertrophy of soft tissues and long bones. The diagnosis is made clinically supplemented with magnetic resonance imaging and computed tomography. Hereby we aim to highlight the significance of the possible life-threatening first-time presentations associated with the GI system in previously undiagnosed KTWS patients. We report the case of a 47-year-old male with KTWS, who presented with various symptoms such as rectorrhagia since childhood, digestive problems and abnormal lateral vascular malformations of the left buttock which extended all the way to the leg, vascular malformations of the left fourth and fifth toes as well as soft tissue swelling of the left foot. There was no evidence of other clinical presentations. The patient was hospitalized with severe rectorrhagia and a hemoglobin level of 3/9. Physical examination revealed a blood pressure of 85/55 and pulse rate of 115. Ruptured aneurysm of the superior mesenteric artery was found on angiography and subsequently treated with embolization. Dermatologic evaluation showed pitting edema of the left leg and foot and multiple vascular lesions. Thus a diagnosis of KTWS was established. Pulsed dye laser therapy and compression bandage was performed for the patient. The patient's follow-up was done 3 months after discharge for which the patient was again consulted by a dermatologist and gastroenterologist. Lymphedema of the left leg had improved to a great extend so treatment with compression bandage was continued. Colonoscopy was repeated for the patient to evaluate and control possible active sources of bleeding, due to potential life-threating complications. According to previous findings, there have been few case reports of KTWS presenting with gastrointestinal manifestations, fewer of which have covered acute life-threatening bleedings associated with this system.

O06 Clinical phenotype of the Klippel-Trenaunay syndrome with mosaic PIK3R1 mutations

Abstract Segmental overgrowth syndromes with cutaneous vascular malformations (Klippel-Trenaunay syndrome (KTS), CLOVES syndrome) are mainly due to mosaic PIK3CA mutations, but the GNAQ, GNA11, HRAS, KRAS, MAP2K1, AKT1, AKT3, and PIK3R1 genes may also be involved. We sought to determine the frequency and phenotype of patients with PIK3R1-related segmental overgrowth. Patients were ascertained nationwide in the French MUSTARD cohort of skin mosaic phenotypes. We searched for PIK3R1 mutations by next-generation sequencing on affected tissue in 297 patients with a clinical presentation suggestive of PIK3CA related overgrowth (PROS), but without PIK3CA variants. We retrospectively studied the clinical phenotype of PIK3R1-positive patients. We identified three missense variants and six in-phase indels of PIK3R1 in 15 patients (5.0%), exclusively in affected tissue. Variant allele fraction was 2.0% to 12.0%. We found extensive pale or dark capillary malformations in 14 patients, segmental overgrowth in 11, venous truncal anomalies (varicose veins or persistent lateral marginal vein) in 10, lymphatic malformation in six and a café-­au-lait macule or naevus spilus in three, thus defining phacomatosis pigmento-vascularis (PPV). One patient had limb hypoplasia. None had MCAP (Megalencephaly-Capillary malformation). PIKR1 mutations account for a minority of patients with KTS/CLOVES (5%). They are about 20 times less common than PIK3CA mutations. Truncal venous malformations, limb hypoplasia and PPV (spilorosea or melanorosea type) may be more common in PIK3R1-related KTS. No patient had severe or life-threatening involvement. Whether Sirolimus or Alpelisib are treatment options remains to be determined.

Erythematous capillary-lymphatic malformations mimicking blood vascular anomalies.

Superficial erythematous cutaneous vascular malformations are assumed to be blood vascular in origin, but cutaneous lymphatic malformations can contain blood and appear red. Management may be different and so an accurate diagnosis is important. Cutaneous malformations were investigated through 2D histology and 3D whole-mount histology. Two lesions were clinically considered as port-wine birthmarks and another 3 lesions as erythematous telangiectasias. The aims were (i) to demonstrate that cutaneous erythematous malformations including telangiectasia can represent a lymphatic phenotype, (ii) to determine if lesions represent expanded but otherwise normal or malformed lymphatics, and (iii) to determine if the presence of erythrocytes explained the red color. Microscopy revealed all lesions as lymphatic structures. Port-wine birthmarks proved to be cystic lesions, with nonuniform lymphatic marker expression and a disconnected lymphatic network suggesting a lymphatic malformation. Erythematous telangiectasias represented expanded but nonmalformed lymphatics. Blood within lymphatics appeared to explain the color. Blood-lymphatic shunts could be detected in the erythematous telangiectasia. In conclusion, erythematous cutaneous capillary lesions may be lymphatic in origin but clinically indistinguishable from blood vascular malformations. Biopsy is advised for correct phenotyping and management. Erythrocytes are the likely explanation for color accessing lymphatics through lympho-venous shunts.

Successful Management of Neonatal Kaposiform Haemangioendothelioma and Kasabach-Merritt Phenomenon Using Sirolimus and Surgical Excision

: Kaposiform haemangioendothelioma (KHE) is a rare vascular tumor, occurring predominantly in infancy, with an incidence of 0.091 per 100,000 children. Typically presenting as a solitary large cutaneous lesion with no distant metastases. Children with KHE are at high risk of developing the Kasabach-Merritt phenomenon (KMP), a consumptive coagulopathy. KMP is defined as profound thrombocytopenia, hypofibrinogenemia, and elevated D-dimer. KMP has a mortality of 10 - 30%. Due to its rarity, there is little robust evidence for KHE management. Rapamycin (mTOR) inhibitors are a safe and effective treatment. This report is of a newborn full-term infant with no antenatal complications, presenting with abdominal cutaneous vascular malformation and, subsequently, coagulopathy.

Cutaneous Hypervascularization Treatment Using Photo-Mediated Ultrasound Therapy

Photo-mediated ultrasound therapy (PUT) is a cavitation-based, highly selective antivascular technique. In this study, the effectiveness and safety of PUT on cutaneous vascular malformation was examined through invivo experiments in a clinically relevant chicken wattle model, whose microanatomy is similar to that of port-wine stain and other hypervascular dermal diseases in humans. Assessed by optical coherence tomography angiography, the blood vessel density in the chicken wattle decreased by 73.23% after one session of PUT treatment in which 0.707 J/cm2 fluence laser pulses were applied concurrently with ultrasound bursts (n= 7, P < .01). The effectiveness of removing blood vessels in the skin at depth up to 1 mm was further assessed by H&E-stained histology at multiple time points, which included days 1, 3, 7, 14, and 21 after treatment. Additional immunohistochemical analyses with CD31, caspase-3, and Masson's trichrome stains were performed on day 3 after treatment. The results show that the PUT-induced therapeutic effect was confined and specific to blood vessels only, whereas unwanted collateral damage in other skin tissues such as collagen was avoided. The findings from this study demonstrate that PUT can efficiently and safely remove hypervascular dermal capillaries using laser fluence at a level that is orders of magnitude smaller than that used in conventional laser treatment of vascular lesions, thus offering a safer alternative technique for clinical management of cutaneous vascular malformations.

BG09 RASA1 exon deletion in a neonate with vascular malformations

Abstract A full-term infant was noted to have a large, macular, pale-pink vascular birthmark across the left side of the chest, extending to the upper arm. Three smaller pale-pink irregular birthmarks on the elbow, thigh and flank were noted, as was an enlarged left upper arm. He had an oxygen dependency shortly after birth for which he required admission to the neonatal unit. A detailed history revealed that his father, paternal grandmother and aunt had similar birthmarks. His paternal aunt had an episode of bleeding from a spinal arteriovenous malformation (AVM) in her teens, which had been investigated with genetic testing by Sanger sequencing, but this did not identify a variant in RASA1. Following involvement from the dermatology, neonatology, genetics and radiology teams, investigations were organized. Findings included a high-flow vascular malformation with arteriovenous shunting on magnetic resonance imaging (MRI) of the left arm, normal MRI head and spine, and normal cardiac anatomy. Genetic testing by next-generation sequencing detected a heterozygous exon 21–23 deletion in RASA1. A diagnosis of capillary malformation–AVM syndrome (CM–AVM) was confirmed. Results of genetic testing of the father are awaited. Referral to a tertiary centre for consideration of management of AVM is underway. CM–AVM is a rare autosomal dominant condition. Pathogenic variants in RASA1 result in a lack of functional p120-RasGAP protein, which leads to abnormalities in angiogenesis, although this pathway is not well understood (Wooderchak-Donahue W, Johnson P, McDonald J et al. Expanding the clinical and molecular findings in RASA1 capillary malformation-arteriovenous malformation. Eur J Hum Genet 2018; 26:1521–36). Cutaneous vascular malformations, classically pink–red with a pale halo, are the most consistent cutaneous manifestation, but they may be subtle and can mimic other vascular birthmarks such as segmental infantile haemangioma, salmon patches or port wine stain. In our patient, pale halos were not apparent until 4 months of age. Identification is important as life-threatening complications from cutaneous vascular arteriovenous fistulas can occur (Wooderchak-Donahue et al.). This case highlights the importance of clarifying a family history, classifying vascular birthmarks and working with the multidisciplinary team. Genetic testing should be considered, even with previous negative analysis, as test sensitivity has improved and will now include analysis of EPHB4, which has also been associated with CM–AVM.

Head and Neck Low Flow Vascular Lesions Treated with Corseting Technique

Head and neck vascular lesions management has been a great challenge to the surgeons due to catastrophic bleeding that obscures the visibility during the surgery. A proposed surgical technique called CORSET SUTURING for the treatment of non cutaneous low-flow vascular malformations in the head and neck region minimizes the blood loss and facial disfigurement. Corset sutures are placed to strangulate the lesion and restore the facial symmetry with the least amount of comorbidities. The aim of the present study is to describe the clinical characteristics of patients treated by corset suturing technique, material used and surgical morbidity, in order to contribute to a better understanding of this technique. Medical records and images of 15 patients treated by the same corset suturing protocol were retrieved and analysed. The indications, advantages and disadvantages, technique and complications observed are discussed. There was a significant reduction in the bulkiness of tumour mass noted and also a return of the regional facial outline was evident. In conclusion, corset suturing has an important role in management of diffuse low-flow vascular malformations of the head and neck as it is found to be a simple, cost-effective, less scarring and acceptable method, hence can be considered as an alternative to the other expensive methods such as embolization, with least surgical comorbidities.

574 Preliminary results from an escalating dose cohort study of VT30, a topically formulated phosphatidylinositol 3-kinase inhibitor (PI3K), intended as a treatment for cutaneous vascular malformations associated with underlying PIK3CA or TEK mutations

Purpose: This report gives findings from an (ongoing) Phase 1b, escalating dose, clinical trial, assessing the safety and tolerability of VT30 Topical Gel as a treatment for venous, lymphatic and mixed venolymphatic lesions of the skin (VM, LM and VLM, respectively), driven by inappropriate activation of intracellular PI3K. Methods: After giving informed consent and completing screening evaluations that included a confirmation of underlying genotype (PIK3CA or TEK mutation), adult subjects with cutaneous VM, LM or VLM lesions were allocated to receive 4 weeks (wks) of Topical VT30 Gel, applied once daily to a 140 cm2 target treatment area, with lesion involvement. Four sequential, open-label escalating dose cohorts of 3 subjects each (12 total) were designed for sequential completion as follows: Cohort 1, 2 wks of 0.12% (concentration strength) gel, followed by the final 2 wks at 0.6%; Cohort 2, 2 wks of 0.6% gel, followed by the final 2 wks at 1.2%; Cohort 3, 2 wks of 1.2 % gel, followed by the final 2 wks at 2.3%; and Cohort 4, a full 4 wks at the maximum tolerated or maximum feasible dose (MTD or MFD, respectively) concentration. Results: 23 potential subjects were screened to allocate a total of 12 - 7 were positive for a PIK3CA mutation, and 5 had an underlying TEK mutation. Over 12 subjects treated in Cohorts 1 – 4, VT30 topical gel has been generally safe and tolerated. To date, patient assessments have reflected a phenotypically heterogeneous group. Investigators have reported changes consistent with an improvement in underlying vascular lesions. Adequate tissue-drug levels have been documented in association with a pharmacodynamic readout suggesting local PI3K inhibition. No circulating drug has been detected in plasma. Conclusions: VT30 Topical Gel’s emerging profile is consistent with a potential treatment for patients with vascular malformations of the skin, driven by inappropriate PI3K activation.

De novo cerebral cavernous malformations with PIK3CA somatic mutation and EPHB4 germline mutation in a child with multiple developmental venous anomalies and cutaneous vascular malformations.

Cavernous malformations (CM) that arise in the central nervous system have long been considered congenital, while there are many reports of de novo non-familial-type CM adjacent to developmental venous anomalies (DVA) or after radiation. The mechanisms that cause de novo formations of sporadic cavernous malformation (CM) still remain unknown and purely speculative. We report a case of de novo cerebral CM in a child with multiple developmental venous anomalies and cutaneous vascular malformations. Histological examination and whole-exome sequencing (WES) was performed on a fresh-frozen tissue sample of the CM. WES revealed 2 missense non-synonymous variants in two genes, EPHB4 and PIK3CA. The mutant allele of EPHB4 (NM_004444.4: c.1840T > C, p.Y614H) appeared in 248/469 WES reads (allele frequency, 52.88%), which suggested the mutation a germline one. PIK3CA (NM_006218.2) somatic mutations were found in exon 9: c.1624G > A (p.Glu542Lys) with variant frequency of 2.2% (2/89 WES reads). We did not find any non-synonymous mutations of the three CCM genes (KRIT1, CCM2, and PDCD10) in this patient. Our findings suggested that the combination of gain of function in PIK3CA and loss of function in EPHB4 may play an important role in the pathogenesis of CM, which can develop in acquired form like tumorigenesis.

Endovascular Biopsy for Detection of Somatic Mosaicism in Human Fusiform Cerebral Aneurysms

HomeStroke: Vascular and Interventional NeurologyVol. 2, No. 5Endovascular Biopsy for Detection of Somatic Mosaicism in Human Fusiform Cerebral Aneurysms Open AccessLetterPDF/EPUBAboutView PDFView EPUBSections ToolsAdd to favoritesDownload citationsTrack citations ShareShare onFacebookTwitterLinked InMendeleyReddit Jump toOpen AccessLetterPDF/EPUBEndovascular Biopsy for Detection of Somatic Mosaicism in Human Fusiform Cerebral Aneurysms Joseph H. Garcia, Ethan A. Winkler, MD, PhD, Kerstin Müller, PhD, Evan Kao, PhD, Kazim Narsinh, MD, Nerissa Ko, MD, Patricia Cornett, MD, Adib A. Abla, MD, Joseph T. Shieh, MD, PhD and Daniel L. Cooke, MD Joseph H. GarciaJoseph H. Garcia , Department of Radiology and Biomedical Imaging, , University of California San Francisco, , San Francisco, , CA, , Department of Neurological Surgery, , University of California San Francisco, , San Francisco, , CA, Search for more papers by this author , Ethan A. WinklerEthan A. Winkler , Department of Neurological Surgery, , University of California San Francisco, , San Francisco, , CA, , Department of Neurological Surgery, , Barrow Neurological Institute, , Phoenix, , AZ, Search for more papers by this author , Kerstin MüllerKerstin Müller , Siemens Medical Solutions Inc, , Malvern, , PA, Search for more papers by this author , Evan KaoEvan Kao , Department of Radiology and Biomedical Imaging, , University of California San Francisco, , San Francisco, , CA, Search for more papers by this author , Kazim NarsinhKazim Narsinh , Department of Radiology and Biomedical Imaging, , University of California San Francisco, , San Francisco, , CA, Search for more papers by this author , Nerissa KoNerissa Ko , Department of Neurology, , University of California San Francisco, , San Francisco, , CA, Search for more papers by this author , Patricia CornettPatricia Cornett , Division of Hematology and Oncology, , Department of Medicine, , University of California San Francisco, , San Francisco, , CA, Search for more papers by this author , Adib A. AblaAdib A. Abla , Department of Neurological Surgery, , University of California San Francisco, , San Francisco, , CA, Search for more papers by this author , Joseph T. ShiehJoseph T. Shieh , Division of Medical Genetics, , Department of Pediatrics, , University of California San Francisco, , San Francisco, , CA, , Institute of Human Genetics, , University of California San Francisco, , San Francisco, , CA, Search for more papers by this author and Daniel L. CookeDaniel L. Cooke *Correspondence to: Daniel L. Cooke, MD, Department of Radiology and Biomedical Imaging, University of California San Francisco, Neurointerventional Radiology Zuckerberg San Francisco General Hospital, San Francisco Veterans Affairs Medical Center, 505 Parnassus Ave, L‐349, San Francisco, CA 94143. E‐mail: E-mail Address: [email protected] https://orcid.org/0000-0002-3694-413X , Department of Radiology and Biomedical Imaging, , University of California San Francisco, , San Francisco, , CA, Search for more papers by this author Originally published18 Jul 2022https://doi.org/10.1161/SVIN.122.000354Stroke: Vascular and Interventional Neurology. 2022;2:e000354Other version(s) of this articleYou are viewing the most recent version of this article. Previous versions: July 18, 2022: Ahead of Print Endovascular biopsy is an emerging percutaneous technology to acquire genetic information from the endothelial lining of cerebrovascular pathologic conditions with angiography. Initial applications have relied on laboratory‐based genome‐wide sequencing technologies, limiting widespread clinical adoption. Somatic activating DNA mutations occur in human cerebrovascular pathologic conditions and contribute to cerebral aneurysm pathogenesis.1 Targeted molecular classification may facilitate application of precision‐based therapeutics in cerebrovascular medicine, especially to aneurysms not amenable to existing endovascular or open surgical procedures. Herein, we describe the first in‐human use of endovascular biopsy to detect a pathogenic somatic activating mutation in dolichoectatic fusiform cerebral aneurysms.MethodsPatient specimens and clinical data were obtained with protocols approved by the University of California San Francisco institutional review board and ethics committee. Written informed consented was obtained. Endovascular biopsy was performed in 4 adults presenting with dolichoectatic fusiform cerebral aneurysms, including 1 patient with a known missense gain‐of‐function variant (PDGFRB c1685A>G p.[Tyr562Cys]) detected in a cutaneous vascular malformation on a next‐generation sequencing–based gene panel, as previously described.2 Briefly, cells were extracted off a 0.035‐in Benson wire or detachable platinum coil deployed in the iliac artery or cerebral aneurysm, respectively, to yield patient‐matched peripheral artery or aneurysm cell specimens. Cells were extracted with mechanical agitation in enzyme‐free Cell Dissociation Buffer (Thermo Fisher Scientific, Waltham, MA) and snap frozen. Genomic DNA was extracted with the Quick‐DNA microprep kit (Zymo Research, Irvine, CA) and amplified with the PicoPLEX Single Cell Whole Genome Amplification Kit, as instructed by the manufacturer (Takara Bio USA, San Jose, CA). Genomic DNA integrity was confirmed by electrophoretic analysis on an Agilent 4200 TapeStation System after amplification (Agilent Technologies, Inc, Santa Clara, CA). Digital droplet polymerase chain reaction (ddPCR) was performed with a QX100 ddPCR System using a custom‐designed genotyping primer and probe mix to detect the PDGFRB c1685A>G p.(Tyr562Cys) variant (unique assay identifier: dHsaMDS963465264), and analysis was performed with QuantaSoft v1.4 (Bio‐Rad Laboratories, Hercules, CA). All data are presented as mean±SD.ResultsEndovascular biopsy was performed in a cohort of 4 adults presenting with dolichoectatic fusiform cerebral aneurysms (mean age, 59.8±22.4 years). Each aneurysm was fusiform in morphology, with mean diameter of 17.9±2.0 mm. Biopsied aneurysms included 3 dolichoectatic vertebrobasilar aneurysms and 1 fusiform middle cerebral artery aneurysm. Two patients had multiple aneurysms. No hemorrhagic or thrombotic complications related to the biopsy occurred, and endovascular biopsy yielded 2096.1±342.6 ng of DNA (iliac artery, 2040.0±130.2 ng; aneurysm, 2152.2±498.6; P=0.68).Using molecular information from the next‐generation sequencing–based gene panel to inform targeted downstream analytics, we performed ddPCR to detect the same PDGFRB variant in endovascular biopsy‐acquired cells. Notably, we detected the PDGFRB variant from both the aneurysm and patient‐matched peripheral vessel in the index patient (Figure 1). Variant‐to‐allele frequencies were 2.8% and 0.9% for the aneurysm and iliac artery, respectively. The variant was not detected in the 3 patients without cutaneous manifestations. Thus, endovascular biopsy may identify somatic activating mutations in fusiform cerebral aneurysms using targeted molecular assays.Download figureDownload PowerPointFigure 1. Endovascular biopsy of human fusiform cerebral aneurysms.A, Anterior‐posterior projection of cerebral angiogram, showing dolichoectatic fusiform cerebral aneurysm of middle cerebral artery in a 25‐year‐old woman with cutaneous nodules. Injection, right internal carotid artery. B, Representative subtracted roadmap visualization of endovascular biopsy of middle cerebral artery aneurysm. Endovascular biopsy is performed by deploying a platinum coil selectively within the aneurysm, allowing 1 minute of contact with the endothelial lining, and then resheathing the coil. Cells are extracted off the coil, and genetic material is isolated for analysis. C, Visualization of PDGFRB variants detected by digital droplet polymerase chain reaction. The x axis indicates amplitude of positive signal; y axis, paired patient samples; blue dots, positive for PDGFRB c1685A>G p.(Tyr562Cys) variant; arrows, representative positive droplets; red box, index patient with cutaneous manifestations. a indicates aneurysm; and pv, peripheral vessel.DiscussionHerein, we report the first in‐human use of endovascular biopsy to detect somatic activating mutations in dolichoectatic fusiform cerebral aneurysms. Prior endovascular biopsy applications have used genome‐wide sequencing techniques to compare gene expression profiles between patient‐matched peripheral vessels and cerebral aneurysms to infer pathologic changes. Such an approach requires computational methods not readily applicable to clinical specimens and prone to false positives. By contrast, the presented series leverages an incredibly rare case in which cutaneous molecular profiles were used to inform targeted molecular analysis of endovascular biopsy (EB)‐acquired cells from cerebral aneurysms. Thus, these findings further support the feasibility and fidelity of EB to acquire disease‐relevant molecular aberrations with angiography and targeted ddPCR.We notably only detected the somatic activating mutation in the index patient with cutaneous manifestations,3 but none of the other aneurysms sampled. Whether this is reflective of technical variations, regional variations, or the molecular heterogeneity of cerebral aneurysms remains to be determined. One additional patient showed rare positive droplets, likely the product of expected false positivity with rare mutation events, and future studies with larger cohorts are needed to refine thresholds to detect rare somatic mutation events with greater confidence. Ongoing sequencing efforts continue to evolve our understanding of the molecular genetics of cerebral aneurysms, mainly from peripheral blood specimens or surgically acquired tissues.4 As our molecular understanding matures, larger panels of genes may be assembled to perform targeted molecular classification, such as somatic mutation detection or aberrancy in specified gene pathways, in aneurysms or other difficult to treat cerebrovascular pathologic conditions to inform biologic risk stratification with endovascular biopsy in living patients. Treatment outcomes remain suboptimal for dolichoectatic fusiform aneurysms.5 Future studies are warranted to investigate whether endovascular biopsy may yield clinically relevant targetable molecular information to allow trials in precision‐based medicine for fusiform cerebral aneurysms.AcknowledgmentsThe authors would like to acknowledge Siemens Healthineers in their continued support of neurovascular radiogenomics investigation.Footnotes*Correspondence to: Daniel L. Cooke, MD, Department of Radiology and Biomedical Imaging, University of California San Francisco, Neurointerventional Radiology Zuckerberg San Francisco General Hospital, San Francisco Veterans Affairs Medical Center, 505 Parnassus Ave, L‐349, San Francisco, CA 94143. E‐mail: daniel.[email protected]edu#J. H. Garcia and Dr Winkler contributed equally.References1 Karasozen Y, Osbun JW, Parada CA, Busald T, Tatman P, Gonzalez‐Cuyar LF, Hale CJ, Alcantara D, O'Driscoll M, Dobyns WB, et al. Somatic PDGFRB activating variants in fusiform cerebral aneurysms. Am J Hum Genet. 2019; 104:968‐976.CrossrefMedlineGoogle Scholar2 Narsinh KH, Narsinh K, McCoy DB, Sun Z, Halabi C, Meisel K, Tihan T, Chaganti K, Amans MR, Halbach VV, et al. Endovascular biopsy of vertebrobasilar aneurysm in patient with polyarteritis nodosa. Front Neurol. 2021; 12:697105.Google Scholar3 Chenbhanich J, Hu Y, Hetts S, Cooke D, Dowd C, Devine P, UCLA Clinical Genomics Center , Russell B, Kang SHL, Chang VY, et al. Segmental overgrowth and aneurysms due to mosaic pdgfrb p.(tyr562cys). Am J Med Genet A. 2021; 185:1430‐1436.CrossrefMedlineGoogle Scholar4 Barak T, Ristori E, Ercan‐Sencicek AG, Miyagishima DF, Nelson‐Williams C, Dong W, Jin SC, Prendergast A, Armero W, Henegariu O, et al. Ppil4 is essential for brain angiogenesis and implicated in intracranial aneurysms in humans. Nat Med. 2021; 27:2165‐2175.CrossrefGoogle Scholar5 Lawton MT, Abla AA, Rutledge WC, Benet A, Zador Z, Rayz VL, Saloner D, Halbach VV. Bypass surgery for the treatment of dolichoectatic basilar trunk aneurysms: a work in progress. Neurosurgery. 2016; 79:83‐99.CrossrefGoogle Scholar Previous Back to top Next FiguresReferencesRelatedDetails September 2022Vol 2, Issue 5Article InformationMetrics © 2022 The Authors. Published on behalf of the American Heart Association, Inc., and the Society of Vascular and Interventional Neurology by Wiley Periodicals LLC.This is an open access article under the terms of the Creative Commons Attribution‐NonCommercial License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes.https://doi.org/10.1161/SVIN.122.000354 Manuscript receivedJanuary 20, 2022Manuscript acceptedMay 23, 2022Originally publishedJuly 18, 2022 PDF download

A PEDIATRIC CASE OF TEK-RELATED MALFORMATIONS AND MARFANOID HABITUS: AN INCIDENTAL FINDING OR A FEATURE?

Vascular malformations encompass a wide range of complex vascular lesions. Due to the extreme variability of clinical presentation, classification and their related syndromes presents a challenge. Here we describe a case of a boy presenting with Marfanoid habitus, cutaneous vascular malformations, and severe acute anemia due to ileal venous malformations. Although a panel of genetic markers for the Marfan phenotype was negative, we identified a de novo mutation in the TEK gene in the patient. This case supports expansion of the phenotypic spectrum of TEK-related vascular malformations.

Cardio-facio-cutaneous syndrome and gastrointestinal defects: report on a newborn with 19p13.3 deletion including the MAP 2 K2 gene

BackgroundCardio-facio-cutaneous syndrome (CFCS) belongs to RASopathies, a group of conditions caused by mutations in genes encoding proteins of the rat sarcoma/mitogen-activated protein kinase (RAS/MAPK) pathway. It is a rare syndrome, with about 300 patients reported. Main clinical manifestations include facial dysmorphisms, growth failure, heart defects, developmental delay, and ectodermal abnormalities. Mutations (mainly missense) of four genes (BRAF, MAP 2 K1, MAP 2 K2, and KRAS) have been associated to CFCS. However, whole gene deletions/duplications and chromosomal microdeletions have been also reported. Specifically, 19p13.3 deletion including MAP 2 K2 gene are responsible for cardio-facio-cutaneous microdeletion syndrome, whose affected subjects show more severe phenotype than CFCS general population.Case presentationHereby, we report on a female newborn with prenatal diagnosis of omphalocele, leading to further genetic investigations through amniocentesis. Among these, array comparative genomic hybridization (a-CGH) identified a 19p13.3 microdeletion, spanning 1.27 Mb and including MAP 2 K2 gene. Clinical features at birth (coarse face with dysmorphic features, sparse and friable hair, cutaneous vascular malformations and hyperkeratotic lesions, interventricular septal defect, and omphalocele) were compatible with CFCS diagnosis, and further postnatal genetic investigations were not considered necessary. Soon after discharge, at around 1 month of life, she was readmitted to our Neonatal Intensive Care Unit due to repeated episodes of vomiting, subtending a hypertrophic pyloric stenosis (HPS) which was promptly identified and treated.ConclusionsOur report supports the 19p13.3 microdeletion as a contiguous gene syndrome, in which the involvement of the genes contiguous to MAP 2 K2 may modify the patients’ phenotype. It highlights how CFCS affected subjects, including those with 19p13.3 deletions, may have associated gastrointestinal defects (e.g., omphalocele and HPS), providing further data on 19p13.3 microdeletion syndrome, and a better characterization of its genomic and phenotypic features. The complex clinical picture of such patients may be worsened by additional, and even precocious, life-threatening conditions like HPS. Clinicians must consider, anticipate and/or promptly treat possible medical and surgical complications, with the aim of reducing adverse outcomes. Extensive diagnostic work-up, and early, continuous, and multidisciplinary follow-up, as well as integrated care, are necessary for the longitudinal clinical evolution of any single patient.

Blue Rubber Bleb Nevus Syndrome: A Rare Case of Gastrointestinal Hemorrhage Necessitating Bowel Resection.

Blue Rubber Bleb Nevus Syndrome is a congenital rarity that manifests as vascular malformations throughout the body, including the gastrointestinal tract. With fewer than 300 cases reported, the etiology and clinical course is poorly understood; however, the literature suggests TEK mutations on chromosome 9 result in unregulated angiogenesis. We present the case of a young female treated for anemia of unknown etiology who presented in hemorrhagic shock due to gastrointestinal hemorrhage necessitating small bowel resection, with cutaneous, intestinal, hepatic, and lingual vascular malformations associated with a single somatic pathologic TEK mutation. Although uncommon, this case suggests that Blue Rubber Bleb Nevus Syndrome should be considered in the differential of a patient with persistent anemia and cutaneous lesions, carrying the potential for multiple gastrointestinal vascular malformations progressing to hemorrhage necessitating operative management. Additionally, a severe phenotype can occur without a double-hit TEK mutation.

EP097: The utility of CSF-derived cell free DNA in molecular diagnostics for the Megalencephaly-capillary Malformation (MCAP) syndrome: A case report

The Megalencephaly-capillary malformation (MCAP) syndrome is an overgrowth syndrome caused by mosaic gain-of-function (activating) variants in the PIK3CA gene. This multi-system disorder is characterized by megalencephaly (MEG) or hemimegalencaphly (HMEG), cutaneous vascular malformations, variable somatic overgrowth, digital anomalies, and connective tissue laxity. Epilepsy is commonly associated with MCAP, and a subset of affected individuals have cortical malformations which may require resective epilepsy surgery.

Characterizing dermatologic findings among patients with PTEN hamartoma tumor syndrome: Results of a multicenter cohort study

BackgroundDermatologic phenotypes in PTEN hamartoma tumor syndrome (PHTS) are heterogeneous and poorly documented. ObjectiveTo characterize dermatologic findings among PHTS and conduct an analysis of genotype-dermatologic phenotype associations. MethodsMucocutaneous findings were reviewed in a multicenter cohort study of PHTS. Genotype-dermatologic phenotype associations were tested using multivariable regression. ResultsA total of 201 patients were included. Children were significantly less likely than adults to have oral papillomas, vascular malformations, benign follicular neoplasms, and acral keratoses. There were no cases of skin cancer among children. Basal cell carcinoma, cutaneous squamous cell carcinoma, and melanoma developed in 5%, 2%, and 1% of White adults, respectively. After adjusting for age, missense mutations were associated with 60% lower odds of developing cutaneous papillomatous papules (odds ratio: 0.4; 95% confidence interval [0.2, 0.7]), oral papillomas (0.4; 95% confidence interval [0.2, 0.9]), and vascular malformations (0.4; 95% confidence interval [0.2, 0.8]). LimitationsPartly retrospective data. ConclusionChildren are less likely than adults to have certain dermatologic findings, likely due to age-related penetrance. The risk of pediatric melanoma and the lifetime risk of nonmelanoma skin cancer in PHTS may not be elevated. Missense variants may be associated with the development of fewer dermatologic findings but future validation is required.

Phacomatosis pigmentovascularis with sturge-weber syndrome and congenital glaucoma: A rare case report.

Phacomatosis pigmentovascularis (PPV) is a rare congenital disease characterized by the co-existence of cutaneous vascular malformation and pigmentary nevi with or without extracutaneous systemic involvement. Here, we present a 2-month old child diagnosed with phacomatosis cesioflammea type of PPV with Sturge-Weber syndrome and secondary congenital glaucoma of the left eye. She underwent combined trabeculotomy and trabeculectomy in the left eye for glaucoma and was started on anti-epileptics for seizure control following pediatric evaluation. Early screening and treatment initiation can prevent blindness and other systemic complications associated with PPV.

Clinical and neuroimaging findings in 33 patients with MCAP syndrome: A survey to evaluate relevant endpoints for future clinical trials.

Megalencephaly-CApillary malformation-Polymicrogyria (MCAP) syndrome results from somatic mosaic gain-of-function variants in PIK3CA. Main features are macrocephaly, somatic overgrowth, cutaneous vascular malformations, connective tissue dysplasia, neurodevelopmental delay, and brain anomalies. The objectives of this study were to describe the clinical and radiological features of MCAP, to suggest relevant clinical endpoints applicable in future trials of targeted drug therapy. Based on a French collaboration, we collected clinical features of 33 patients (21 females, 12 males, median age of 9.9 years) with MCAP carrying mosaic PIK3CA pathogenic variants. MRI images were reviewed for 21 patients. The main clinical features reported were macrocephaly at birth (20/31), postnatal macrocephaly (31/32), body/facial asymmetry (21/33), cutaneous capillary malformations (naevus flammeus 28/33, cutis marmorata 17/33). Intellectual disability was present in 15 patients. Among the MRI images reviewed, the neuroimaging findings were megalencephaly (20/21), thickening of corpus callosum (16/21), Chiari malformation (12/21), ventriculomegaly/hydrocephaly (10/21), cerebral asymmetry (6/21) and polymicrogyria (2/21). This study confirms the main known clinical features that defines MCAP syndrome. Taking into account the phenotypic heterogeneity in MCAP patients, in the context of emerging clinical trials, we suggest that patients should be evaluated based on the main neurocognitive expression on each patient.

Detailed analysis of phenotypes and genotypes in megalencephaly-capillary malformation-polymicrogyria syndrome caused by somatic mosaicism of PIK3CA mutations

BackgroundMegalencephaly-capillary malformation-polymicrogyria syndrome (MCAP) belongs to a group of conditions called the PIK3CA-related overgrowth spectrum (PROS). The varying phenotypes and low frequencies of each somatic mosaic variant make confirmative diagnosis difficult. We present 12 patients who were diagnosed clinically and genetically with MCAP. Genomic DNA was extracted mainly from the skin of affected lesions, also from peripheral blood leukocytes and buccal epithelial cells, and target panel sequencing using high-depth next-generation sequencing technology was performed.ResultsMacrocephaly was present in 11/12 patients (92%). All patients had normal body asymmetry. Cutaneous vascular malformation was found in 10/12 patients (83%). Megalencephaly or hemimegalencephaly was noted in all 11 patients who underwent brain magnetic resonance imaging. Arnold–Chiari type I malformation was also seen in 10 patients. Every patient was identified as having pathogenic or likely pathogenic variants of the PIK3CA gene. The variant allele frequency (VAF) ranged from 6.3 to 35.3%, however, there was no direct correlation between VAF and the severity of associated anomalies. c.2740G > A (p.Gly914Arg) was most commonly found, in four patients (33%). No malignancies developed during follow-up periods.ConclusionsThis is the first and largest cohort of molecularly diagnosed patients with MCAP in Korea. Targeted therapy with a PI3K-specific inhibitor, alpelisib, has shown successful outcomes in patients with PROS in a pilot clinical study, so early diagnosis for genetic counseling and timely introduction of emerging treatments might be achieved in the future through optimal genetic testing.

Identification of a Mosaic Activating Mutation in GNA11 in Atypical Sturge-Weber Syndrome

Sturge-Weber syndrome (SWS) (Online Mendelian Inheritance in Man #185300) is a capillary malformation condition (Bichsel and Bischoff, 2019Bichsel C. Bischoff J. A somatic missense mutation in GNAQ causes capillary malformation.Curr Opin Hematol. 2019; 26: 179-184Crossref PubMed Scopus (10) Google Scholar; Comi, 2015Comi A.M. Sturge-Weber syndrome.Handb Clin Neurol. 2015; 132: 157-168Crossref PubMed Scopus (37) Google Scholar). Affected regions include the skin (typically with facial cutaneous vascular malformations called port-wine birthmarks), brain (often resulting in seizures, intellectual disability, and recurrent stroke-like episodes), and eye (often causing glaucoma). We (Shirley et al., 2013Shirley M.D. Tang H. Gallione C.J. Baugher J.D. Frelin L.P. Cohen B. et al.Sturge-Weber syndrome and port-wine stains caused by somatic mutation in GNAQ.N Engl J Med. 2013; 368: 1971-1979Crossref PubMed Scopus (558) Google Scholar) and others (Frigerio et al., 2015Frigerio A. Wright K. Wooderchak-Donahue W. Tan O.T. Margraf R. Stevenson D.A. et al.Genetic variants associated with port-wine stains.PLoS One. 2015; 10e0133158Crossref PubMed Scopus (27) Google Scholar; Nakashima et al., 2014Nakashima M. Miyajima M. Sugano H. Iimura Y. Kato M. Tsurusaki Y. et al.The somatic GNAQ mutation c.548G>A (p.R183Q) is consistently found in Sturge-Weber syndrome.J Hum Genet. 2014; 59: 691-693Crossref PubMed Scopus (66) Google Scholar) reported that 90% of individuals with SWS or nonsyndromic port-wine birthmarks have a mosaic, activating mutation in GNAQ, encoding Gαq. The same mutation at other sites on the skin can also result in cutaneous vascular and soft tissue overgrowth and underlying malformations (Gao et al., 2017Gao L. Yin R. Wang H. Guo W. Song W. Nelson J.S. et al.Ultrastructural characterization of hyperactive endothelial cells, pericytes and fibroblasts in hypertrophic and nodular port-wine stain lesions.Br J Dermatol. 2017; 177: e105-e108Crossref PubMed Scopus (5) Google Scholar; Ma et al., 2018Ma G. Yu Z. Liu F. Wang L. Yu W. Zhu J. et al.Somatic GNAQ mutation in different structures of port-wine macrocheilia.Br J Dermatol. 2018; 179: 1109-1114Crossref PubMed Scopus (6) Google Scholar; Tan et al., 2016Tan W. Nadora D.M. Gao L. Wang G. Mihm Jr., M.C. Nelson J.S. The somatic GNAQ mutation (R183Q) is primarily located within the blood vessels of port wine stains.J Am Acad Dermatol. 2016; 74: 380-383Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). Identification of other noncanonical pathogenic mutations may elucidate further the pathophysiology of SWS and/or port-wine birthmarks and define genetic subtypes. Based on targeted next-generation sequencing, we identified five individuals with SWS and/or port-wine birthmarks who were negative for GNAQ R183Q mutations (Table 1). These studies were performed with Johns Hopkins Institutional Review Board approval. Written informed consent was obtained by the National Institutes of Health NeuroBioBank that provided samples. We set the lower threshold for calling mutations at 10 times the sequencing error rate for Q30 base quality scores, that is, a 1% mutant allele frequency. One case (SWS 3) had mutant allele frequencies of 0.58% and 0.22% in two independent affected brain samples. These values were below the 1% threshold for calling a mutation but significantly above background frequencies of other samples (range, 0.02–0.12%, n = 10, P < 0.00074, two-tailed t-test).Table 1Demographics and Results of Targeted GNAQ p.R183 Sequencing and WESCaseAgeSexRace1Ethnicity was C or U.SampleRegion (Source)2Brain samples were from right hemisphere (SWS 2) or bilateral (SWS 1, SWS 4, SWS 5).Status3Samples were from regions presumed to be Aff or Unaff.GNAQ AF4Targeted amplicon sequencing of GNAQ exon 4 was performed using forward primer 5′-GGGTATTCGATGATCCCTGTGGTGGG-3′ and reverse primer 5′-CCTTTCCGTAGACAGCTTTGGTGTGATG-3′.WESWES Candidates5WES was performed on eight samples using the Illumina HiSeq 2500 (Illumina, San Diego, CA) platform with Agilent SureSelect_V5 enrichment kit (Agilent, Santa Clara, CA) targeting 50,390,601 base pairs. Read length was 150 base pairs with total reads ranging from 35.9 to 40.4 million. The mean depth of coverage of targeted regions was ×69.SWS 115 y 89 dFCSWS1-BBrain (surg)Aff0.101NoneSWS 263 y 235 dMCSWS2-BBrain (PM)Aff0.062NoneSWS2-BPCBrain (PM)AffND——SWS2-SASkin (PM)Aff0.023GNA11 p.R183CSWS2-SA2Skin (PM)AffND——SWS2-SUASkin (PM)UnaffND4NoneSWS 32 y 6 moMUSWS3-BABrain (surg)Aff0.58——SWS3-B1Brain (surg)Aff0.225GNAQ p.R183QSWS3-B2Brain (surg)AffND——SWS 419 y 352 dMCSWS4-B1Brain (PM)Aff0.056NoneSWS4-B2Brain (PM)Aff0.12——SWS 55 y 12 dFCSWS5-BUBrain (PM)Unaff0.057NoneSWS5-BABrain (PM)Aff0.078GPRC6A6We identified a candidate gene mutation in case SWS 5, which had no evidence for mosaic mutations in GNAQ or GNA11. Utilizing DNA from affected brain tissue, we identified a mosaic mutation in GPRC6A. DNA from affected brain tissue had a mosaic predicted nonsense mutation (63 C residues, 4 A residues; 6.0% mutant AF). The GPRC6A G-protein coupled receptor senses high concentrations of extracellular calcium (and possibly amino acids and/or osteocalcin) and couples to Gαq (Pi et al., 2005). However, germline loss of function variants are extremely common (e.g., 6% population allele frequency for SNP rs550458778, and 39 loss of function variant alleles listed in the ExAC database [gnomeAD browser, 2019]). We therefore conclude that, although the mutation we observed appears somatic rather than germline, it is not pathogenic.Abbreviations: AF, allele frequency; Aff, affected; C, Caucasian; ExAC, Exome Aggregation Consortium; F, female; M, male; ND, not determined; PM, postmortem; SNP, single nucleotide polymorphism; Surg, surgical specimen; SWS, Sturge-Weber syndrome; U, unknown; Unaff, unaffected; WES, whole exome sequencing.1 Ethnicity was C or U.2 Brain samples were from right hemisphere (SWS 2) or bilateral (SWS 1, SWS 4, SWS 5).3 Samples were from regions presumed to be Aff or Unaff.4 Targeted amplicon sequencing of GNAQ exon 4 was performed using forward primer 5′-GGGTATTCGATGATCCCTGTGGTGGG-3′ and reverse primer 5′-CCTTTCCGTAGACAGCTTTGGTGTGATG-3′.5 WES was performed on eight samples using the Illumina HiSeq 2500 (Illumina, San Diego, CA) platform with Agilent SureSelect_V5 enrichment kit (Agilent, Santa Clara, CA) targeting 50,390,601 base pairs. Read length was 150 base pairs with total reads ranging from 35.9 to 40.4 million. The mean depth of coverage of targeted regions was ×69.6 We identified a candidate gene mutation in case SWS 5, which had no evidence for mosaic mutations in GNAQ or GNA11. Utilizing DNA from affected brain tissue, we identified a mosaic mutation in GPRC6A. DNA from affected brain tissue had a mosaic predicted nonsense mutation (63 C residues, 4 A residues; 6.0% mutant AF). The GPRC6A G-protein coupled receptor senses high concentrations of extracellular calcium (and possibly amino acids and/or osteocalcin) and couples to Gαq (Pi et al., 2005Pi M. Faber P. Ekema G. Jackson P.D. Ting A. Wang N. et al.Identification of a novel extracellular cation-sensing G-protein-coupled receptor.J Biol Chem. 2005; 280: 40201-40209Abstract Full Text Full Text PDF PubMed Scopus (249) Google Scholar). However, germline loss of function variants are extremely common (e.g., 6% population allele frequency for SNP rs550458778, and 39 loss of function variant alleles listed in the ExAC database [gnomAD browser., 2019gnomAD browser. GPRC6A: G protein-coupled receptor class c group 6 member A, https://gnomad.broadinstitute.org/gene/ENSG00000173612?dataset=gnomad_r2_1; 2019 (accessed 26 August 2020).Google Scholar]). We therefore conclude that, although the mutation we observed appears somatic rather than germline, it is not pathogenic. Open table in a new tab Abbreviations: AF, allele frequency; Aff, affected; C, Caucasian; ExAC, Exome Aggregation Consortium; F, female; M, male; ND, not determined; PM, postmortem; SNP, single nucleotide polymorphism; Surg, surgical specimen; SWS, Sturge-Weber syndrome; U, unknown; Unaff, unaffected; WES, whole exome sequencing. We next performed whole exome sequencing and somatic variant calling to identify candidate causal mutations (Table 1). Case SWS 3 had 20 reads covering the GNAQ p.R183Q locus with 18 reference C reads, one T (5%) predicted to produce the R183Q mutation, and one A (5%) predicted to be synonymous. Targeted amplicon sequencing of exon 4 of GNAQ validated a T minor allele frequency (MAF) of 0.27% (22 of 8,030 reads) in SWS 3 and revealed a 0.1% (9 of 8,028) MAF in a control (NA12878). We conclude that the mutant allele frequency was less than the conservative threshold of 1% or greater variant nucleotides, but this low-level mosaic variation was nonetheless pathogenic. We suggest that, in an appropriate clinical or research setting, a lower threshold of ≥0.25% for calling a mutation may be justified, particularly when supported by large read depth by targeted amplicon sequencing as reported here. Our results are consistent with those of Uchiyama et al., 2016Uchiyama Y. Nakashima M. Watanabe S. Miyajima M. Taguri M. Miyatake S. et al.Ultra-sensitive droplet digital PCR for detecting a low-prevalence somatic GNAQ mutation in Sturge-Weber syndrome.Sci Rep. 2016; 6 ([published correction appears in Sci Rep 2017;7:39897]): 22985Crossref PubMed Scopus (37) Google Scholar, who suggested a minimum MAF threshold of 1% by next-generation sequencing, 0.25% using droplet digital PCR, and 0.1% using peptide nucleic acid combined with droplet digital PCR. Case SWS 2, a 63-year-old male, had negligible levels of GNAQ p.R183Q by targeted sequencing (0.02% and 0.06% in DNA from two separate brain samples) or by exome sequencing (22 C reads, zero alternate alleles). However, we identified a 6.1% mutant allele frequency of GNA11 p.R183Q mutation (93 C residues, 6 T residues) by whole exome sequencing, a finding validated by targeted next-generation sequencing in three separate affected tissue samples (MAFs in three brain regions were 0.7%, 1.9%, and 1.9%; MAF was 5.9% in affected skin and 0.06% in unaffected skin and 0.12% in control individual NA12878) (Table 2). The human GNA11 gene encodes Gα11 (NP_002058.2, 359 amino acids) that shares 90% amino acid identity with Gαq (NP_002063.2; also 359 amino acids). Germline mutations in GNA11 can cause hypocalciuric hypercalcemia type II (Online Mendelian Inheritance in Man #145981) and hypocalcemia dominant 2 (Online Mendelian Inheritance in Man #615361). Couto et al., 2017Couto J.A. Ayturk U.M. Konczyk D.J. Goss J.A. Huang A.Y. Hann S. et al.A somatic GNA11 mutation is associated with extremity capillary malformation and overgrowth.Angiogenesis. 2017; 20: 303-306Crossref PubMed Scopus (68) Google Scholar reported a mosaic, activating missense mutation in GNA11 (c.547C >T; p.Arg183Cys) in three patients with a diffuse capillary malformation of an extremity, whereas Thomas et al., 2016Thomas A.C. Zeng Z. Rivière J.B. O’Shaughnessy R. Al-Olabi L. St-Onge J. et al.Mosaic activating mutations in GNA11 and GNAQ are associated with phakomatosis pigmentovascularis and extensive dermal melanocytosis.J Invest Dermatol. 2016; 136: 770-778Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar identified GNA11 p.R183C or p.R183S in four patients with phakomatosis pigmentovascularis, including sites of vascular and pigmentary skin lesions. Associated pigmentary lesions in phakomatosis pigmentovascularis include melanocytic nevi; café au lait macules; dermal melanocytosis; and epidermal nevi and vascular lesions, including capillary and venous malformations and nevus anemicus (Fernández-Guarino et al., 2008Fernández-Guarino M. Boixeda P. de Las Heras E. Aboin S. García-Millán C. Olasolo P.J. Phakomatosis pigmentovascularis: clinical findings in 15 patients and review of the literature.J Am Acad Dermatol. 2008; 58: 88-93Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar). GNA11-activating mutations have also been reported in uveal melanoma and blue nevi (Van Raamsdonk et al., 2010Van Raamsdonk C.D. Griewank K.G. Crosby M.B. Garrido M.C. Vemula S. Wiesner T. et al.Mutations in GNA11 in uveal melanoma.N Engl J Med. 2010; 363: 2191-2199Crossref PubMed Scopus (983) Google Scholar). Subject SWS 2 was diagnosed with meningeal angiomatosis with clinical suspicion of SWS on postmortem pathology; however, there were atypical features both clinically and pathologically. He had extensive port-wine involvement of the face and body on his right side, but no history of seizures, hemiparesis, or neurologic deficits before his acute hypertensive event; left thalamic and right subarachnoid bleeds; and infarct. Postmortem macroscopic neuropathologic evaluation revealed thickened, vascular congested leptomeninges, with what appeared to be an underdeveloped vascularity. Microscopic evaluation demonstrated dilated venules, degenerated arterial walls with thickening and myxoid substance, calcification, and evidence of macrophage accumulation (Figure 1). Additional patients exhibiting pathologic GNA11 mutations and features that overlap with SWS are needed to determine whether they all display a milder neurologic phenotype and later neurologic onset with hemorrhage than the typical patient with SWS and a R183Q somatic mutation in GNAQ.Table 2Targeted Sequencing Data for GNA11SampleRegionNucleotide CallAF1Mutant AF (percentage of T of total). Targeted amplicon sequencing of GNA11 exon 4 was performed using forward primer 5′- GTGCTGTGTCCCTGTCCTG -3′ and reverse primer 5′- GGCAAATGAGCCTCTCAGTG -3′.CATGSWS 2Brain7,9904610.07SWS 2Brain7,813915131.9SWS 2Brain7,831715711.9SWS 2Skin (affected)7,471646945.9SWS 2Skin (unaffected)8,0117500.06NA12878Blood7,98541010.12Abbreviations: AF, allele frequency; SWS, Sturge-Weber syndrome.1 Mutant AF (percentage of T of total). Targeted amplicon sequencing of GNA11 exon 4 was performed using forward primer 5′- GTGCTGTGTCCCTGTCCTG -3′ and reverse primer 5′- GGCAAATGAGCCTCTCAGTG -3′. Open table in a new tab Abbreviations: AF, allele frequency; SWS, Sturge-Weber syndrome. Data from this study are available upon request to JP. Jeremy Thorpe: http://orcid.org/0000-0002-6700-1513 Laurence P. Frelin: http://orcid.org/0000-0002-0514-5722 Meghan McCann: http://orcid.org/0000-0003-2081-4645 Carlos A. Pardo: http://orcid.org/0000-0002-4128-5335 Bernard A. Cohen: http://orcid.org/0000-0001-5213-6936 Anne M. Comi: http://orcid.org/0000-0001-7915-6881 Jonathan Pevsner: http://orcid.org/0000-0002-6328-0842 The authors state no conflicts of interest. We thank the individuals with Sturge-Weber syndrome and their families for participating in this study. We are grateful to the National Institutes of Health (NIH) NeuroBioBank for providing us the samples. We thank Macrogen Clinical Laboratories for kindly donating resources (to JP) to perform whole exome sequencing. We thank N. Varg for helpful discussions. AMC was supported by funding from the Celebrate Hope Foundation and the Faneca 66 Foundation . JP was supported by NIH grants U01 MH106884 and U54 HD079123 and by the Sturge-Weber Foundation . This work was supported by grants from the NIH (Lawton, Comi, and Marchuk) (grant number U54NS065705 ). The Brain Vascular Malformation Consortium (grant number U54NS065705 ) is a part of the NIH Rare Diseases Clinical Research Network, supported through the collaboration between the NIH Office of Rare Diseases Research at the National Center for Advancing Translational Science and the National Institute of Neurological Disorders and Stroke. Conceptualization: AMC, JP; Data Curation: JT, JP; Formal Analysis: JT, JP; Funding Acquisition: AMC, JP; Investigation: JT, LPF, MM, CAP, BAC, AMC, JP; Methodology: JT, LPF, MM, CAP, BAC, AMC, JP; Project Administration: AMC, JP; Resources: AMC, JP; Software: JT, JP; Supervision: AMC, JP; Validation: JT, LPF, MM, CAP, BAC, AMC, JP; Visualization: MM, CAP, BAC, AMC; Writing - Original Draft Preparation: JT, AMC, JP; Writing - Review and Editing: AMC, JP

Cutaneous findings of familial cerebral cavernous malformation syndrome due to the common Hispanic mutation.

Familial cerebral cavernous malformations due to the common Hispanic mutation (FCCM1-CHM) is an endemic condition among the Hispanic population of the Southwestern United States associated with significant morbidity and mortality. Cutaneous vascular malformations (CVMs) can be found in individuals with FCCM1-CHM, but their morphology, prevalence, and association with cerebral cavernous malformations (CCMs) has not been well characterized. A cross-sectional study of 140 individuals with confirmed FCCM1-CHM was performed with statistical analyses of CVM, CCM, and patient characteristics. We then compared these findings to other cohorts with Familial cerebral cavernous malformations (FCCM) due to other mutations. We observed a higher overall prevalence and a different predominant morphological subtype of CVM compared to previous FCCM cohorts. While the number of CVMs was not a reliable indicator of the number of CCMs present, each person with one or more CVMs had evidence of central nervous system (CNS) disease. Awareness of the morphology of these cutaneous lesions can aid in the diagnosis of individuals with FCCM-CHM in Hispanic patients or those with family history of CCM.